αsat (Cell Signaling Technology Inc)
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 
93
Structured Review
Cell Signaling Technology Inc
αsat
αsat, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B1sat/SimpleChIP+Human+alpha+Satellite+Repeat+Primers/pm39422615-262-7-8
Average 93 stars, based on 25 article reviews
αsat, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B1sat/SimpleChIP+Human+alpha+Satellite+Repeat+Primers/pm39422615-262-7-8
Average 93 stars, based on 25 article reviews
αsat - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Real-time Polymerase Chain Reaction:Article Title: Werner syndrome RECQ helicase participates in and directs maintenance of the protein complexes of constitutive heterochromatin in proliferating human cells Article Snippet: ChIP was performed according to the Abcam protocol as described in , with 5μg of chromatin using rabbit α-Histone H3K9me3 Cat. No. A2217P (Diagenode) antibody or the equivalent amount of rabbit IgG Cat. No. C15410206 (Diagenode). .. Input and pulldown DNA was analyzed in triplicates by qPCR with iTaq Universal SYBR Green supermix (Bio-Rad) and the following pairs of primers: LINE1 5’UTR: 5’GATGATGGTGATGTACAGATGGG3’ and 5’AGCCTAACTGGGAGGCACCC3’ ( ) SATII: 5’TCATCGAATGGAAATGAAAGGAGTCATCATCT3’ and 5’CGACCATTGGATGATTGCAGTCAA3’ ( ); SYBR Green Assay:Article Title: Werner syndrome RECQ helicase participates in and directs maintenance of the protein complexes of constitutive heterochromatin in proliferating human cells Article Snippet: ChIP was performed according to the Abcam protocol as described in , with 5μg of chromatin using rabbit α-Histone H3K9me3 Cat. No. A2217P (Diagenode) antibody or the equivalent amount of rabbit IgG Cat. No. C15410206 (Diagenode). .. Input and pulldown DNA was analyzed in triplicates by qPCR with iTaq Universal SYBR Green supermix (Bio-Rad) and the following pairs of primers: LINE1 5’UTR: 5’GATGATGGTGATGTACAGATGGG3’ and 5’AGCCTAACTGGGAGGCACCC3’ ( ) SATII: 5’TCATCGAATGGAAATGAAAGGAGTCATCATCT3’ and 5’CGACCATTGGATGATTGCAGTCAA3’ ( ); Derivative Assay:Article Title: Genome-wide survey of D/E repeats in human proteins uncovers their instability and aids in identifying their role in the chromatin regulator ATAD2 Article Snippet: Input and pulldown DNA samples were analyzed in triplicates by qPCR with iTaq Universal SYBR Green supermix (Bio-Rad) and the following pairs of primers: Alu ChIP: 5′AATGGTACGATCTCGGCTCA-3′ and 5′TAGCCAGGTGTGGTGACTTG-3′ SATIII ChIP: 5′AATCAACCCGAGTGCAATCNGAATGGAATCG-3′ and 5′TCCATTCCATTCCTGTACTCGG-3′. .. Alu and SATIII primers were described in Shen et al. SATII: 5′TCATCGAATGGAAATGAAAGGAGTCATCATCT-3′ and 5′CGACCATTGGATGATTGCAGTCAA-3′ were derived from the chr.1 SATII sequence, GenBank: X72623.1 . Sequencing:Article Title: Genome-wide survey of D/E repeats in human proteins uncovers their instability and aids in identifying their role in the chromatin regulator ATAD2 Article Snippet: Input and pulldown DNA samples were analyzed in triplicates by qPCR with iTaq Universal SYBR Green supermix (Bio-Rad) and the following pairs of primers: Alu ChIP: 5′AATGGTACGATCTCGGCTCA-3′ and 5′TAGCCAGGTGTGGTGACTTG-3′ SATIII ChIP: 5′AATCAACCCGAGTGCAATCNGAATGGAATCG-3′ and 5′TCCATTCCATTCCTGTACTCGG-3′. .. Alu and SATIII primers were described in Shen et al. SATII: 5′TCATCGAATGGAAATGAAAGGAGTCATCATCT-3′ and 5′CGACCATTGGATGATTGCAGTCAA-3′ were derived from the chr.1 SATII sequence, GenBank: X72623.1 . |
